Sequence ID | >WENV170658963 |
Genome ID | JUGB01002778 |
Phylum/Class | [JUGB] scorpion gut metagenome; ten pooled guts of food-deprived Vaejovis mexicanus smith and Centruroides limpidus |
Species | |
Start position on genome | 137 |
End posion on genome | 212 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cgaaacatgt |
tRNA gene sequence |
GGCCGAGTAGCTCAGTTGGTAGAGCAGGGGATTGAAAATCCCCGTGTCGGCGGTTCGATT |
Downstream region at tRNA end position |
tcttcagaga |
Secondary structure (Cloverleaf model) | >WENV170658963 Phe GAA t ACCA tcttcagaga G - C G - C C - G C - G G - C A - T G + T T T T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A A GTGTC G - C G - C G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |