Sequence ID | >WENV170658966 |
Genome ID | JUGB01003200 |
Phylum/Class | [JUGB] scorpion gut metagenome; ten pooled guts of food-deprived Vaejovis mexicanus smith and Centruroides limpidus |
Species | |
Start position on genome | 590 |
End posion on genome | 506 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tccgatgcga |
tRNA gene sequence |
GCGGTCGTGGCGGAATTGGTAGACGCGCAGCGTTGAGGTCGCTGTGGGGCAACCCGTGGA |
Downstream region at tRNA end position |
tctggctaaa |
Secondary structure (Cloverleaf model) | >WENV170658966 Leu GAG a ACCA tctggctaaa G - C C - G G - C G - C T - A C - G G - C T G T T C T T C A T A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TGGGGCAACCCGT C - G A - T G - C C - G G - C T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |