Sequence ID | >WENV170658975 |
Genome ID | JUGB01004643 |
Phylum/Class | [JUGB] scorpion gut metagenome; ten pooled guts of food-deprived Vaejovis mexicanus smith and Centruroides limpidus |
Species | |
Start position on genome | 171 |
End posion on genome | 85 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tgccgacggg |
tRNA gene sequence |
GCCCAGATGGCGGAATTGGTAGACGCGCTGGCTTCAGGTGCCAGTGGCTTAACGGCCGTG |
Downstream region at tRNA end position |
tattataaac |
Secondary structure (Cloverleaf model) | >WENV170658975 Leu CAG g ACCA tattataaac G - C C - G C - G C - G A - T G - C A - T T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A G G TGGCTTAACGGCCGT C - G T - A G - C G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |