| Sequence ID | >WENV170677492 |
| Genome ID | LDZT01005749 |
| Phylum/Class | [LDZT] terrestrial metagenome; oil reservoir sample SB1 |
| Species | |
| Start position on genome | 1300 |
| End posion on genome | 1375 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
ttgatttaga |
| tRNA gene sequence |
GCGGGAGTAGCTCAGTGGCTAGAGCGTCAGCCTTCCAAGCTGAGGGTCGCGGGTTCGAAT |
| Downstream region at tRNA end position |
tattaagagc |
| Secondary structure (Cloverleaf model) | >WENV170677492 Gly TCC
a TCCA tattaagagc
G - C
C - G
G - C
G - C
G - C
A - T
G + T T A
T T G C C C A
T G A A + | | | | G
G C T C G G C G G G C
G | | | | T T
C G A G C
T A G GGGTC
T - A
C - G
A - T
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |