| Sequence ID | >WENV170679945 |
| Genome ID | LFCJ01001832 |
| Phylum/Class | [LFCJ] soda lake metagenome; sample B1-Br-g2; brine of Lake Bitter-1 |
| Species | |
| Start position on genome | 450 |
| End posion on genome | 375 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
acgacgtacc |
| tRNA gene sequence |
AGCGGGATGGGATAGCCAGGAGATTCCGGCGGGCTCATAACCCGCAGATCGGTAGTTCAA |
| Downstream region at tRNA end position |
ttcgacgcga |
| Secondary structure (Cloverleaf model) | >WENV170679945 Met CAT
c ACtt ttcgacgcga
A - T
G - C
C - G
G - C
G - C
G - C
A - T T A
T C C A T C A
C C G A G | | | | | A
A T A G G G G T A G C
G | | | T T
G T T C C
A G A G AGATC
G - C
C - G
G - C
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |