Sequence ID | >WENV170691716 |
Genome ID | LFUF01004392 |
Phylum/Class | [LFUF] hypersaline lake metagenome; virus filtrate of water collected from the Namib Desert Hosabes playa |
Species | |
Start position on genome | 9161 |
End posion on genome | 9088 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
caccattaac |
tRNA gene sequence |
GATGCGATGGCGGAGTGGCTACGCGACGGGCTGCAACCCCGTTAACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
tataaccctg |
Secondary structure (Cloverleaf model) | >WENV170691716 Cys GCA c TCCA tataaccctg G - C A - T T - A G + T C - G G - C A - T T T T C T C C C A G A G | | | | | G T G G C G G A G G G C G | | | T T G A C G C C T G TAAC A - T C - G G - C G - C G - C C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |