Sequence ID | >WENV170691732 |
Genome ID | LFUF01004392 |
Phylum/Class | [LFUF] hypersaline lake metagenome; virus filtrate of water collected from the Namib Desert Hosabes playa |
Species | |
Start position on genome | 4618 |
End posion on genome | 4544 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ggcggaccat |
tRNA gene sequence |
GCTGGCGTAGCTCAGAGGAAGAGCGCTCGTTTCGTAATCGAGAGGTCGTCGGTTCAACCC |
Downstream region at tRNA end position |
cgtattcccc |
Secondary structure (Cloverleaf model) | >WENV170691732 Thr CGT t ACCA cgtattcccc G - C C - G T - A G - C G - C C - G G - C C C T C A G C C A G A A | | | | | A A C T C G G T C G G C G | | | | T T G G A G C A A G AGGTC C - G T - A C - G G - C T T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |