Sequence ID | >WENV170691756 |
Genome ID | LFUF01004776 |
Phylum/Class | [LFUF] hypersaline lake metagenome; virus filtrate of water collected from the Namib Desert Hosabes playa |
Species | |
Start position on genome | 2139 |
End posion on genome | 2227 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aattacataa |
tRNA gene sequence |
GGAAGATTGGCAGAGTGGATTATTGCACTAGTCTTGAAAACTAGCAGTTACTTATGGTGG |
Downstream region at tRNA end position |
agttcttgct |
Secondary structure (Cloverleaf model) | >WENV170691756 Ser TGA a TCtt agttcttgct G - C G - C A - T A - T G - C A - T T - A T A T C A C C C A T G A G | | | | | A G G A C G G T G G G C G + | | | T T A T T G C T T A A CAGTTACTTATGGTGGCTC C - G T - A A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |