Sequence ID | >WENV170691771 |
Genome ID | LFUF01004844 |
Phylum/Class | [LFUF] hypersaline lake metagenome; virus filtrate of water collected from the Namib Desert Hosabes playa |
Species | |
Start position on genome | 774 |
End posion on genome | 691 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gatttttaat |
tRNA gene sequence |
GGCAGTATGGCTGAGTGGTCGAAGGCGTCCGGTTGTAGCCCGGAAGGATAAAACCCACGG |
Downstream region at tRNA end position |
atttactaac |
Secondary structure (Cloverleaf model) | >WENV170691771 Tyr GTA t ACtt atttactaac G - C G + T C - G A - T G - C T + G A - T T A T C T C T C A T G A G | + | | | A G G T C G G G G A G C G + | | T T T A G G C C G A G AGGATAAAACCCAC T - A C - G C - G G - C G - C T C T G G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |