Sequence ID | >WENV170691808 |
Genome ID | LFUF01006747 |
Phylum/Class | [LFUF] hypersaline lake metagenome; virus filtrate of water collected from the Namib Desert Hosabes playa |
Species | |
Start position on genome | 891 |
End posion on genome | 806 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ctgtcactcT |
tRNA gene sequence |
GCCCCTATGACGGAATTGGTGAGACGTGCGCGATTCAAAATCCCGTGCCCTAGAGGTGTG |
Downstream region at tRNA end position |
aaaagaaagg |
Secondary structure (Cloverleaf model) | >WENV170691808 Leu CAA T ATaa aaaagaaagg G + T C - G C - G C - G C - G T - A A - T T A T C A T C C A T T A A G | | | | | G G G G C A G T A G G C G | | | T T T A C G T G A G G TGCCCTAGAGGTGT C - G G - C C C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |