Sequence ID | >WENV170691812 |
Genome ID | LFUF01006937 |
Phylum/Class | [LFUF] hypersaline lake metagenome; virus filtrate of water collected from the Namib Desert Hosabes playa |
Species | |
Start position on genome | 263 |
End posion on genome | 175 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ctgaaaccaa |
tRNA gene sequence |
GGAAGGGTGGCAGAGTGGTTTATTGCGCTTGGTTGCTAACCAAGTAGTCCTTAATTGTGA |
Downstream region at tRNA end position |
tacactatgc |
Secondary structure (Cloverleaf model) | >WENV170691812 Ser GCT a TCtt tacactatgc G - C G - C A - T A - T G - C G - C G + T T A T T A C T C A T G A G | | | | | G G G A C G A T G A G C G + | | | T T T T T G C T T A G TAGTCCTTAATTGTGACTC C - G T - A T - A G - C G - C T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |