Sequence ID | >WENV170691832 |
Genome ID | LFUF01007933 |
Phylum/Class | [LFUF] hypersaline lake metagenome; virus filtrate of water collected from the Namib Desert Hosabes playa |
Species | |
Start position on genome | 52 |
End posion on genome | 138 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gtactgaaac |
tRNA gene sequence |
AGAGAGATGGCAGAATGGTTATTGCAGCACCTTGCTAAGGTGTAAACGGTAAAACGTTTC |
Downstream region at tRNA end position |
ataaatccaa |
Secondary structure (Cloverleaf model) | >WENV170691832 Ser GCT c GCGA ataaatccaa A - T G - C A - T G - C A - T G - C A - T T G T G A C T C A T A A G | | | | | G G G A C G C T G A G C G + | | | T T T T T G C T A A AAACGGTAAAACGTTT G + T C - G A - T C - G C - G T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |