Sequence ID | >WENV170691849 |
Genome ID | LFUF01009477 |
Phylum/Class | [LFUF] hypersaline lake metagenome; virus filtrate of water collected from the Namib Desert Hosabes playa |
Species | |
Start position on genome | 547 |
End posion on genome | 635 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ctttcttttt |
tRNA gene sequence |
GGAGGGTTGGCAGAGTCAGGTAATGTATCGGGCTTGAACCCCGAAGGCTACCGCAAGGTA |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170691849 Ser TGA t GCCn nnnnnnnnnn G - C G - C A - T G - C G - C G - C T - A T A T C G A C C A T G A G | | | | | G C G A C G G C T G G C A | | + T T G A T G T G T A A AGGCTACCGCAAGGTAGC T - A C - G G - C G - C G - C C C T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |