Sequence ID | >WENV170691867 |
Genome ID | LFUF01010810 |
Phylum/Class | [LFUF] hypersaline lake metagenome; virus filtrate of water collected from the Namib Desert Hosabes playa |
Species | |
Start position on genome | 489 |
End posion on genome | 402 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ctgtctgttt |
tRNA gene sequence |
GCGGGAGTATCCAAGTCAGGCCAAAGGAGATGCGCTCAAAACGCATTCCACGAAGGTGGT |
Downstream region at tRNA end position |
acttatgacc |
Secondary structure (Cloverleaf model) | >WENV170691867 Leu CAA t ACtg acttatgacc G - C C - G G - C G - C G - C A - T G + T T A T T G T C C A C T G A A + | | | | G A A C C T G C A G G C G | | | T T G A G G A C C A A G TCCACGAAGGTGGTAC A - T T - A G - C C - G G - C C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |