Sequence ID | >WENV170691880 |
Genome ID | LFUG01000433 |
Phylum/Class | [LFUG] hypersaline lake metagenome; virus filtrate of water collected from the Namib Desert Eisfeld playa |
Species | |
Start position on genome | 18070 |
End posion on genome | 18140 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
attctttttc |
tRNA gene sequence |
GGGAGGATAGTATAATGGTAGTACACTTGATTTGCAATCAAGAAGTAGGGGTTCAATTCC |
Downstream region at tRNA end position |
actttaacca |
Secondary structure (Cloverleaf model) | >WENV170691880 Ala TGC c Atat actttaacca G - C G - C G + T A A G - C G - C A - T T T T T C C C C A A A A | | | | | A T T A T G A G G G G C G + | | | T T G G T A C T A A AAGT C - G T - A T - A G - C A - T T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |