Sequence ID | >WENV170691903 |
Genome ID | LFUG01001821 |
Phylum/Class | [LFUG] hypersaline lake metagenome; virus filtrate of water collected from the Namib Desert Eisfeld playa |
Species | |
Start position on genome | 545 |
End posion on genome | 630 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ccaaaataac |
tRNA gene sequence |
GGAGGAATGGCAGAGCGGTAATGCGTACGCCTGGAAAGCGTTAGCCTGGGTAACCAGCGG |
Downstream region at tRNA end position |
catttccgcc |
Secondary structure (Cloverleaf model) | >WENV170691903 Ser GGA c GCCA catttccgcc G - C G - C A - T G - C G - C A - T A - T C T T C C T C C A G A G | | | | | G C G A C G G G A G G C G | | | T T G A T G C T A G AGCCTGGGTAACCAGC T T A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |