Sequence ID | >WENV170692154 |
Genome ID | LFUG01021273 |
Phylum/Class | [LFUG] hypersaline lake metagenome; virus filtrate of water collected from the Namib Desert Eisfeld playa |
Species | |
Start position on genome | 51 |
End posion on genome | 140 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
acactgtaaa |
tRNA gene sequence |
GGAAAAGTGGCAGAGTGGTAATGCACCTGTTTTGAAAACAGAGATCTGAATGAAAGTTCA |
Downstream region at tRNA end position |
tataaccctg |
Secondary structure (Cloverleaf model) | >WENV170692154 Ser TGA a GCCA tataaccctg G - C G - C A - T A - T A - T A - T G - C T C T C T T C C A G A G | | + | | G T G A C G G A G G G C G | | | T T G A T G C T A A GATCTGAATGAAAGTTCAGC C A C - G T - A G - C T - A T A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |