The detailed information of tRNA gene sequence


Sequence ID>WENV170694245
Genome IDLGVD01024790
Search identical group
Phylum/Class[LGVD] marine sediment metagenome; sample #3730, Push core (PC) 16 from cruise R/V Atlantis leg AT-15-68, Alvin dive 4635 at
Species
Start position on genome 756
End posion on genome 832
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
agggaaagat
tRNA gene sequence
GGGCCCGTAGCTCAGTTGGTAGAGCGCCTGCATGGCATGTAGGAGGTTCAGGGGTTCGAG
ACCCCTCGGGTCCACAA
Downstream region at tRNA end position
aagatataat
Secondary structure (Cloverleaf model)
>WENV170694245	Ala	GGC
                   t      ACAA aagatataat
                     G - C
                     G - C
                     G + T
                     C - G
                     C - G
                     C - G
                     G - C          A G
                    T     T C C C C     A
      T G A        A      | | | | |     G
    T       C T C G       A G G G G     C
    G       | | | |                 T T
    G       G A G C
      T A          G     AGGTTC
                    C - G
                    C - G
                    T - A
                    G + T
                    C - G
                  A       T
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK