The detailed information of tRNA gene sequence


Sequence ID>WENV170694378
Genome IDLGVD01042535
Search identical group
Phylum/Class[LGVD] marine sediment metagenome; sample #3730, Push core (PC) 16 from cruise R/V Atlantis leg AT-15-68, Alvin dive 4635 at
Species
Start position on genome 1747
End posion on genome 1821
Amino Acid Val
Anticodon CAC
Upstream region at tRNA start position
cctacaaaac
tRNA gene sequence
GGGCGCGTAGCTCAGTTGGTTAGAGCGCACGGTTCACATCCGTGAGGTCGATGGTTCGAG
TCCATTCGCGCCCACtg
Downstream region at tRNA end position
tcatggaccc
Secondary structure (Cloverleaf model)
>WENV170694378	Val	CAC
                   c      ACtg tcatggaccc
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C
                     C - G
                     G - C          T G
                    T     T T A C C     A
      T G A        A      + | | | |     G
    T       C T C G       G A T G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    A - T
                    C - G
                    G - C
                    G - C
                  T       T
                  T       A
                    C A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK