The detailed information of tRNA gene sequence


Sequence ID>WENV170694717
Genome IDLGVE01004054
Search identical group
Phylum/Class[LGVE] marine sediment metagenome; combined push core samples #3730, #5133, and #5579 collected at Hydrate Ridge
Species
Start position on genome 448
End posion on genome 361
Amino Acid Ser
Anticodon TGA
Upstream region at tRNA start position
tttcgcgccc
tRNA gene sequence
GGAGGAATGGCAGAGTGGTCGAATGCGGCGGTCTTGAAAACCGTTGTACCGCAAGGTACC
GGGGGTTCGAATCCCTCTTCCTCCGCCA
Downstream region at tRNA end position
agcaattcaa
Secondary structure (Cloverleaf model)
>WENV170694717	Ser	TGA
                   c      GCCA agcaattcaa
                     G - C
                     G - C
                     A - T
                     G - C
                     G - C
                     A - T
                     A - T          T A
                    T     C T C C C     A
      T G A        G      | + | | |     G
    G       G A C G       G G G G G     C
    G         | | |                 T T
    T       A T G C
      C G A        G     TGTACCGCAAGGTACC
                    G + T
                    C - G
                    G - C
                    G - C
                    T - A
                  C       A
                  T       A
                    T G A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK