The detailed information of tRNA gene sequence


Sequence ID>WENV170695669
Genome IDLGVE01150065
Search identical group
Phylum/Class[LGVE] marine sediment metagenome; combined push core samples #3730, #5133, and #5579 collected at Hydrate Ridge
Species
Start position on genome 991
End posion on genome 1078
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
ttaagatttt
tRNA gene sequence
GCCGGGATGGCGGAATAGGTAGACGCGCCAGCTTGAGGGGCTGGTGAGCTTATTGCTTGT
GGGGGTTCAAATCCCCCTCCCGGCACCA
Downstream region at tRNA end position
ataaatattt
Secondary structure (Cloverleaf model)
>WENV170695669	Leu	GAG
                   t      ACCA ataaatattt
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C
                     A - T          T A
                    T     C C C C C     A
      T A A        G      | | | | |     A
    A       G G C G       G G G G G     C
    G         | | |                 T T
    G       A C G C
      T A G        G     TGAGCTTATTGCTTGT
                    C - G
                    C - G
                    A - T
                    G - C
                    C - G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK