| Sequence ID | >WENV170698400 |
| Genome ID | LGVF01328112 |
| Phylum/Class | [LGVF] marine sediment metagenome; combined push core samples #3730, #5133, and #5579 collected at Hydrate Ridge |
| Species | |
|
Start position on genome
|
529
|
|
End posion on genome
|
605
|
|
Amino Acid
|
Asp
|
|
Anticodon
|
GTC
|
|
Upstream region at tRNA start position
|
ctatttttgc
|
|
tRNA gene sequence
|
GGGGTCGTAGTTAAGTTGGTTATAACGCCGGCCTGTCACGCCGGAGGCCAGGGGTTCGAG TCCCCTCGACCCCGCCA
|
|
Downstream region at tRNA end position
|
taaatattaa
|
| Secondary structure (Cloverleaf model) | >WENV170698400 Asp GTC
c GCCA taaatattaa
G - C
G - C
G - C
G - C
T - A
C - G
G - C T G
T T C C C C A
T G A A | | | | | G
T A T T G A G G G G C
G | | | | T T
G T A A C
T T A G AGGCC
C - G
C - G
G - C
G - C
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |