Sequence ID | >WENV170704209 |
Genome ID | LLEJ01000015 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 13759 |
End posion on genome | 13685 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aaaaaacgat |
tRNA gene sequence |
GGCCCCTTCATCTAGCGGTTAGGATCTTGGATTTTCATTCCAATCACAGGAGTTCGAGTC |
Downstream region at tRNA end position |
tcggtcgatt |
Secondary structure (Cloverleaf model) | >WENV170704209 Glu TTC t ACCA tcggtcgatt G - C G + T C - G C - G C - G C - G T - A T G T T C C T C A C G A C | | | | | G G T C T A A G G A G C G + | | | T T T G G A T T A C TCAC T - A T - A G - C G - C A - T T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |