Sequence ID | >WENV170704210 |
Genome ID | LLEJ01000015 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 13682 |
End posion on genome | 13607 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ggtcaccatc |
tRNA gene sequence |
GGTCGATTAGCTCAGTTGGTAGAGCGCTACCCTTACAAGGTAGACGTCGCAAGTTCGAGT |
Downstream region at tRNA end position |
tttaaaaaat |
Secondary structure (Cloverleaf model) | >WENV170704210 Val TAC c ACCA tttaaaaaat G - C G - C T - A C - G G - C A - T T - A T G T C G T T C A T G A A | | | | | G T C T C G G C A A G C G | | | | T T G G A G C T A G ACGTC C - G T - A A - T C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |