Sequence ID | >WENV170704212 |
Genome ID | LLEJ01000027 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 3945 |
End posion on genome | 4020 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
aaaacgttat |
tRNA gene sequence |
GGCCCGATAGCTCAGTCGGTAGAGCAAAGGATTGAAAATCCTTGTGTCGGCAGTTCGATT |
Downstream region at tRNA end position |
cttattttgg |
Secondary structure (Cloverleaf model) | >WENV170704212 Phe GAA t ACCA cttattttgg G - C G - C C - G C A C - G G - C A - T T T T C C G T C A T G A A | | | | | G C C T C G G G C A G C G | | | | T T G G A G C T A A GTGTC A - T A - T G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |