Sequence ID | >WENV170704217 |
Genome ID | LLEJ01000061 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 14833 |
End posion on genome | 14757 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
agtatacgga |
tRNA gene sequence |
CGCGGGGTGGAGCAGTTTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTTGGTTCAAA |
Downstream region at tRNA end position |
attttcaagt |
Secondary structure (Cloverleaf model) | >WENV170704217 Met CAT a ACCA attttcaagt C A G - C C - G G - C G - C G - C G - C T A T C G A C C A T G A G | + | | | A T C G A G G T T G G C T | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |