Sequence ID | >WENV170704226 |
Genome ID | LLEJ01000235 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 419 |
End posion on genome | 344 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gtacaatgtt |
tRNA gene sequence |
GGAGCTATAGCAAAGTTGGTAATGCCGTGGATTGCAAATCCTCTATGCGTTGGTTCGAGT |
Downstream region at tRNA end position |
cttttttaat |
Secondary structure (Cloverleaf model) | >WENV170704226 Cys GCA t TCCA cttttttaat G - C G - C A - T G - C C - G T - A A - T T G T C A G C C A T G A A | | + | | G T A A C G G T T G G C G | | | T T G A T G C T A C TATGC G - C T T G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |