Sequence ID | >WENV170704228 |
Genome ID | LLEJ01000278 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 6120 |
End posion on genome | 6207 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
acacaaattc |
tRNA gene sequence |
GGTGAGTTGTCCGAGTGGCTGAAGGAGCTCGCCTGGAAAGCGTGTATACGGCAACGTATC |
Downstream region at tRNA end position |
catcaaaaaa |
Secondary structure (Cloverleaf model) | >WENV170704228 Ser GGA c GCCA catcaaaaaa G - C G - C T - A G - C A - T G - C T - A T A T C T C T C A T G A G | | | | | G G G C C T G A G A G C G | | | T T C A G G A T G A G TATACGGCAACGTATC C - G T T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |