Sequence ID | >WENV170704238 |
Genome ID | LLEJ01000508 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 4886 |
End posion on genome | 4961 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aaaaatataa |
tRNA gene sequence |
GCAGGTGTAGCTCAGTTGGAAGAGCAGCGCCCTTCTAAGGCGAAGGTCGCAGGTTCAAGC |
Downstream region at tRNA end position |
tttcataaaa |
Secondary structure (Cloverleaf model) | >WENV170704238 Arg TCT a ACCA tttcataaaa G - C C - G A - T G - C G - C T - A G - C C G T C G T C C A T G A A | | | | | A T C T C G G C A G G C G | | | | T T G G A G C A A A AGGTC G A C - G G - C C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |