Sequence ID | >WENV170704243 |
Genome ID | LLEJ01000528 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 4467 |
End posion on genome | 4551 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
acattatagt |
tRNA gene sequence |
GCGGATGTGGTGAAATTGGTATACACGCTAGACTTAGGATCTAGTGCTTTACGGCGTGAA |
Downstream region at tRNA end position |
tcttattttt |
Secondary structure (Cloverleaf model) | >WENV170704243 Leu TAG t ACCA tcttattttt G - C C - G G - C G - C A - T T - A G - C T G T T T T C C A T A A G + | | | | A T A G T G G A A G G C G | | | T T G A C A C T A T G TGCTTTACGGCGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |