Sequence ID | >WENV170704248 |
Genome ID | LLEJ01000601 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 3526 |
End posion on genome | 3600 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ttatacaagt |
tRNA gene sequence |
TCCGGCATAGCTCAGTGGTAGAGTAGATGACTGTTAATCATTTGGTCCCTGGTTCGAATC |
Downstream region at tRNA end position |
ctacatttaa |
Secondary structure (Cloverleaf model) | >WENV170704248 Asn GTT t GCCA ctacatttaa T - A C - G C - G G - C G - C C - G A - T T A T G G A C C A G A A | | | | | G T C T C G C C T G G C G | | | + T T G G A G T T A A TGGTC G + T A - T T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |