Sequence ID | >WENV170704250 |
Genome ID | LLEJ01000616 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 4227 |
End posion on genome | 4302 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aacctaattc |
tRNA gene sequence |
GGCCCCTTAGCTCAGTGGTTAGAGCGCTCGACTCATAATCGATCGGTCCGCAGTTCAAGT |
Downstream region at tRNA end position |
aattttaaag |
Secondary structure (Cloverleaf model) | >WENV170704250 Met CAT c ACCA aattttaaag G - C G - C C - G C - G C - G C - G T - A T G T G C G T C A T G A A | | | | | A G C T C G C G C A G C G | | | | T T T G A G C T A G CGGTC C T T - A C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |