Sequence ID | >WENV170704261 |
Genome ID | LLEJ01000819 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 747 |
End posion on genome | 834 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
atccacaaaa |
tRNA gene sequence |
GGACAGTTGGGAGAGTGGTCGAATCCGCCACCTTGGAAAGGTGGTGTAGGGCAACTTACC |
Downstream region at tRNA end position |
tttaaagtca |
Secondary structure (Cloverleaf model) | >WENV170704261 Ser GGA a ACCA tttaaagtca G - C G - C A - T C - G A - T G - C T - A T A T C T C C C A T G A G | | | | | A G G A G G G A G G G C G | | | T T T A T C C C G A G TGTAGGGCAACTTACC C - G C - G A - T C - G C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |