Sequence ID | >WENV170704263 |
Genome ID | LLEJ01000842 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1585 |
End posion on genome | 1511 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttttttatac |
tRNA gene sequence |
CGCGGGGTGGAGAAGTGGTATCTCGTCGGGCTCATAACCCGAAGACCACAGGTTCAATTC |
Downstream region at tRNA end position |
attaaaaatc |
Secondary structure (Cloverleaf model) | >WENV170704263 Met CAT c ACCA attaaaaatc C A G - C C - G G - C G - C G - C G - C T T T T G T C C A G A G | | | | | A T A G A G A C A G G C G | | | | T T G T C T C T A G AGACC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |