Sequence ID | >WENV170704269 |
Genome ID | LLEJ01001046 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1135 |
End posion on genome | 1212 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ctttcgtatg |
tRNA gene sequence |
GTGAGATTAGCTCAGTTGGTTAGAGCACTGGTTTGTGGTAGCCGGGGGTCGCGGGTTCGA |
Downstream region at tRNA end position |
ttcaataatc |
Secondary structure (Cloverleaf model) | >WENV170704269 His GTG g CCCA ttcaataatc G - C T - A G - C A - T G - C A - T T - A T A T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T T A A GGGGTC C - G T C G - C G G T - A T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |