Sequence ID | >WENV170704272 |
Genome ID | LLEJ01001046 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1575 |
End posion on genome | 1659 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ctttatttac |
tRNA gene sequence |
GCGGATGTGGTGAAATTGGTATACACGCCAGACTTAGGATCTGGTGCCGCAAGGCGTGGA |
Downstream region at tRNA end position |
ttcataaagc |
Secondary structure (Cloverleaf model) | >WENV170704272 Leu TAG c ACCA ttcataaagc G - C C - G G - C G - C A - T T - A G - C T G T T C T C C A T A A G + | | | | A T A G T G G G A G G C G | | | T T G A C A C T A T G TGCCGCAAGGCGT C - G C - G A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |