Sequence ID | >WENV170704274 |
Genome ID | LLEJ01001076 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 2782 |
End posion on genome | 2866 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ttttataaat |
tRNA gene sequence |
GCGGATATGGTGAAATTGGTATACACGTACGCTTGAGGGGCGTATGGCTTAGGCTGTGGG |
Downstream region at tRNA end position |
taaaagattt |
Secondary structure (Cloverleaf model) | >WENV170704274 Leu GAG t ACCA taaaagattt G - C C - G G - C G - C A - T T - A A - T T G T C C C C C A T A A G | | | | | A T A G T G G G G G G C G | | | T T G A C A C T A T G TGGCTTAGGCTGT T - A A - T C - G G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |