Sequence ID | >WENV170704281 |
Genome ID | LLEJ01001404 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1579 |
End posion on genome | 1654 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
aggaagaaat |
tRNA gene sequence |
GGGTTATTAGCTCAGTTGGTAGAGCAGATCCCTTTTAAGGATAAGGTCCTGGGTTCGAGC |
Downstream region at tRNA end position |
tttgaaaact |
Secondary structure (Cloverleaf model) | >WENV170704281 Lys TTT t ACCA tttgaaaact G - C G - C G - C T - A T + G A - T T - A C G T G G C C C A T G A A | + | | | G T C T C G C T G G G C G | | | | T T G G A G C T A A AGGTC G A A - T T - A C - G C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |