Sequence ID | >WENV170704288 |
Genome ID | LLEJ01001752 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 2367 |
End posion on genome | 2450 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
caactcacaa |
tRNA gene sequence |
GCCAGAGTGGTGGAACGGTATACACGGCGGATTCAAAATCCGCTGCCTTCGGGCTTAGGG |
Downstream region at tRNA end position |
ctaacctaca |
Secondary structure (Cloverleaf model) | >WENV170704288 Leu CAA a ACCA ctaacctaca G + T C - G C - G A - T G - C A - T G - C T A T T C C C C A C A A G | | | | | A G G G T G A G G G G C G | | | T T T A C A C A T G TGCCTTCGGGCTT G - C C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |