Sequence ID | >WENV170704294 |
Genome ID | LLEJ01002099 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1597 |
End posion on genome | 1523 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cttaaaaagt |
tRNA gene sequence |
TGGGGTATCGCCAAGCGGTAAGGCAACGGCTTTTGGTGCCGTCATTCGAAGGTTCGAATC |
Downstream region at tRNA end position |
tttaagtatc |
Secondary structure (Cloverleaf model) | >WENV170704294 Gln TTG t TCCA tttaagtatc T - A G - C G - C G - C G - C T - A A - T T A T C T T C C A G A C | | | | | G C A C C G G A A G G C G | | | T T G A G G C T A A CATTC A - T C - G G - C G - C C - G T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |