Sequence ID | >WENV170704305 |
Genome ID | LLEJ01002531 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 650 |
End posion on genome | 734 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tttttgataa |
tRNA gene sequence |
GCCTGAATGATGGAATTGGTAGACATGAGGGATTCAAAATCCCTTGGCTTCGGTCGTGTG |
Downstream region at tRNA end position |
aaactatgtt |
Secondary structure (Cloverleaf model) | >WENV170704305 Leu CAA a ACCA aaactatgtt G - C C - G C - G T - A G + T A - T A - T T T T C A C C C A T A A G | | | | | G T G G T A G T G G G C G | | | T T G A C A T T A G G TGGCTTCGGTCGT A - T G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |