Sequence ID | >WENV170704311 |
Genome ID | LLEJ01002664 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1354 |
End posion on genome | 1428 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tattgtctgt |
tRNA gene sequence |
GCTCTCGTGGCTCAGGGGTAGAGCACTTCCTTGGTAAGGAAGAGGCCGGCGGTTCAAATC |
Downstream region at tRNA end position |
ttttgaaaat |
Secondary structure (Cloverleaf model) | >WENV170704311 Thr GGT t TCCA ttttgaaaat G - C C - G T - A C - G T T C - G G - C T A T T C G C C A G A G + | | | | A G C T C G G G C G G C G | | | | T T G G A G C T A A AGGCC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |