Sequence ID | >WENV170704312 |
Genome ID | LLEJ01002665 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1110 |
End posion on genome | 1184 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tcaacgatgt |
tRNA gene sequence |
GCGTGCATCGTATAATGGCTATTACCTCAGCCTTCCAAGCTGATGATGTGGGTTCGATTC |
Downstream region at tRNA end position |
agttgtctct |
Secondary structure (Cloverleaf model) | >WENV170704312 Gly TCC t TCCA agttgtctct G - C C - G G - C T - A G - C C - G A - T T T T C A C C C A T A A C | | | | | G G T A T G G T G G G C G | | | T T C T T A C T A C TGAT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |