Sequence ID | >WENV170704313 |
Genome ID | LLEJ01002694 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1260 |
End posion on genome | 1186 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
acaaaaaatt |
tRNA gene sequence |
GCGGGAATAGCTCAGTGGTAGAGCACAACCTTGCCAAGGTTGGGGTCGCGAGTTCGAACC |
Downstream region at tRNA end position |
tttaaaattg |
Secondary structure (Cloverleaf model) | >WENV170704313 Gly GCC t TCCA tttaaaattg G - C C - G G - C G - C G - C A - T A - T C A T T G C T C A G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A A GGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |