Sequence ID | >WENV170704314 |
Genome ID | LLEJ01002694 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1152 |
End posion on genome | 1066 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cattcattat |
tRNA gene sequence |
GCCCGGATGGCGAAATTGGTAGACGCAGGGGACTTAAAATCCCCCGGTAGCAATACTGTG |
Downstream region at tRNA end position |
ttgaaatgaa |
Secondary structure (Cloverleaf model) | >WENV170704314 Leu TAA t ACCA ttgaaatgaa G - C C - G C - G C - G G - C G - C A - T T G T C G G C C A T A A G | | | | | A T A G C G G C C G G C G | | | T T G A C G C T A G A CGGTAGCAATACTGT G - C G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |