Sequence ID | >WENV170704315 |
Genome ID | LLEJ01002694 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1047 |
End posion on genome | 974 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aaagataact |
tRNA gene sequence |
GGTGCCATCGCCAAGTGGTAAGGCCGCAGCCTGCAAAGCTGCTATCCCCAGTTCAAATCT |
Downstream region at tRNA end position |
gttttatttt |
Secondary structure (Cloverleaf model) | >WENV170704315 Cys GCA t TCCA gttttatttt G - C G - C T - A G - C C - G C - G A - T T A T G G G T C A G A C | | | | | A T A C C G C C C A G C G | | | T T G A G G C T A C TATC G - C C - G A - T G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |