Sequence ID | >WENV170704316 |
Genome ID | LLEJ01002694 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 938 |
End posion on genome | 850 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tacaaaatgt |
tRNA gene sequence |
GGATCTTTGGCAGAGTTGGTCGAATGCACTGGTCTTGAAAACCAGCGAGGGTTATACCTC |
Downstream region at tRNA end position |
cttttttaca |
Secondary structure (Cloverleaf model) | >WENV170704316 Ser TGA t ACCA cttttttaca G - C G - C A - T T + G C - G T + G T - A T A T G T C T C A T T G A G | | | | | G G G A C G C A G A G C G | | | T T T A T G C C G A A CGAGGGTTATACCTCC C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |