Sequence ID | >WENV170704332 |
Genome ID | LLEJ01003889 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 902 |
End posion on genome | 988 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cgcttctacc |
tRNA gene sequence |
GCCCGGATGGCGGAATAGGTAGACGCAAGGGACTTAAAATCCCTCGAAGGTAACTTCGTG |
Downstream region at tRNA end position |
tatataacaa |
Secondary structure (Cloverleaf model) | >WENV170704332 Leu TAA c ACCA tatataacaa G - C C - G C - G C - G G - C G - C A - T T T T C G G C C A T A A G | | | | | G A G G C G G C C G G C G | | | T T G A C G C T A G A CGAAGGTAACTTCGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |