Sequence ID | >WENV170704336 |
Genome ID | LLEJ01004110 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 654 |
End posion on genome | 738 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aggcttaagt |
tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGATCAGACTGTAAATCTGACGGCTCAGCCTTCGGT |
Downstream region at tRNA end position |
tatttcgatt |
Secondary structure (Cloverleaf model) | >WENV170704336 Tyr GTA t ACCA tatttcgatt G - C G - C A - T G - C G - C G - C G + T T A T C C A C C A T G A T | | | | | G G G C C C G G T G G C G | | | T T C A G G G C A A A CGGCTCAGCCTTC T - A C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |