Sequence ID | >WENV170704340 |
Genome ID | LLEJ01004133 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1000 |
End posion on genome | 927 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
cattaattaa |
tRNA gene sequence |
GGTGCCATGGTAGAGTGGTCATACACCGGTCTGCAACACCGTTTACTCGGGTTCGAACCC |
Downstream region at tRNA end position |
tgactaattt |
Secondary structure (Cloverleaf model) | >WENV170704340 Cys GCA a TCCA tgactaattt G - C G - C T - A G - C C - G C - G A - T C A T A G C C C A G A G | | | | | G T G A T G T C G G G C G | | | T T G A T A C T C A TTAC C T C - G G - C G - C T - A C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |